Red Cotton™ gRNA Plasmid Bank

location： Home > Products > Red Cotton™ gRNA Plasmid Bank >

EZ-editor™

Gene-eidting Series Products

With 15 years of experience, Ubigene has exclusively innovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

Request a quote Right Now!

EZ-editor™

Gene-editing Series Products

With 14 years of experience, Ubigene has exclusivelyinnovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

EZ-editor™ Gene-editing Series Products

CRISPR-iScreen™ Library

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID	Size	Price (USD)	Turnaround	Resistance	Product Name	Type of Plasmid	Catalog#	gRNA Sequence
55593	≥2ug	80	3-5(business day)	EGFP/Hygro	OTUD5 gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV005-OTUD5[gRNA1-gRNA2]	CGCCGGGCGCTCTTCATCGC GGCGGCTGCAGCACGCATCG	Order Strategy
5290	≥2ug	80	3-5(business day)	EGFP/puro	PIK3CA gRNA4 KO plasmid	Lentiviral Plasmid	YKO-LV001-PIK3CA[gRNA4]	ATGATGCACGTCATGGTGGC	Order Strategy
2260	≥2ug	80	3-5(business day)	EGFP/puro	FGFR1 gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV001-FGFR1[gRNA1-gRNA2]	GTAATACTTTCCACCTATAC TTCTTTGGACGGCTGACTAT	Order Strategy
2778	≥2ug	80	3-5(business day)	EGFP/puro/cas9	GNAS gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-GNAS[gRNA1-gRNA2]	TAAGTCTCAGGTTATGAAGG AGTAAGTGTCAAATCTGTGC	Order Strategy
5879	≥2ug	80	3-5(business day)	EGFP/puro/cas9	RAC1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-RAC1[gRNA1-gRNA2]	TGTCCCAGCCATCCTAGAGA ACCCCTGGGCTTGCATCTAG	Order Strategy
406959	≥2ug	80	3-5(business day)	EGFP/puro/cas9	MIR-183 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-MIR-183[gRNA1-gRNA2]	GACCGTAGCAGCCGCTGCTG AAGTGGGTAAGGTGCTCCGG	Order Strategy
55294	≥2ug	80	3-5(business day)	EGFP/BSD	FBXW7 gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV015-FBXW7[gRNA1-gRNA2]	GTTGGAGTAGAACCTAGACC TAGATTTATTTCGGTAGATG	Order Strategy
1108	≥2ug	80	3-5(business day)	EGFP/BSD	CHD4 gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV015-CHD4[gRNA1-gRNA2]	GAGGGCAGCGACTATACTCC GAGCAAATCCAAGCGGAAGG	Order Strategy
3091	≥2ug	80	3-5(business day)	EGFP/puro	Hif1a gRNA5-gRNA6 KO plasmid	Regular Plasmid	YKO-RP009-Hif1a[gRNA5-gRNA6]	GGTGAAGAGGGAGCAAATCA AGTCAGCTGACCCTAGCACT	Order Strategy
5894	≥2ug	80	3-5(business day)	EGFP/puro/cas9	RAF1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-RAF1[gRNA1-gRNA2]	TACCTACTATGTGTGTGGAC GACATCGAAATCCATTGAGC	Order Strategy

8 9 10 11 12

Product Name	Price (USD)
OTUD5 gRNA1-gRNA2 KO plasmid	80	Order Strategy
PIK3CA gRNA4 KO plasmid	80	Order Strategy
FGFR1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
GNAS gRNA1-gRNA2 KO plasmid	80	Order Strategy
RAC1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
MIR-183 gRNA1-gRNA2 KO plasmid	80	Order Strategy
FBXW7 gRNA1-gRNA2 KO plasmid	80	Order Strategy
CHD4 gRNA1-gRNA2 KO plasmid	80	Order Strategy
Hif1a gRNA5-gRNA6 KO plasmid	80	Order Strategy
RAF1 gRNA1-gRNA2 KO plasmid	80	Order Strategy

8 9 10 11 12

Subscribe Us

* E-mail：

Country/Region：

Name：

By subscription, you consent to allow Ubigene Biosciences to store and process the information provided above to deliver the latest news, research spotlight, and promotions. You can unsubscribe from these communications at anytime.